Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST572-1
Clone ID PST572-1
Vector U3NeoSV1
Project escells

Sequence tag PST572-1
Sequence
GGTCCAGGTGTGACCAGCCACCTGGAAAGCCATCGCTAACCCTCCTGCTTTAATCCCAAGTTTGCACTTTTCAGAGATGG
GAATCTGGTGTCTTCGGCTGGGCACCATTCTCCTCTACCCCCAAACAGGTTACTTCCAACTTGGGAAAGATGATCTTGAA
AGAAGAGATGGAAAAGTCATTGCCCATCCGGAGGAAAACACGCTCTCTGCCTGACCGGACACCCTTCCATACCTGTGAGT
GCTGTGGAGTGTGCTCCGGGTCATCTGGCCAGGGGTGGGTGTGGGGTGGACGGATGTGTGTGTNNCTATTGAACCATTAT
ACTTAAAGGCTCAGTCTAGGGGTGAGGCCCACAGGTGTACTCCTTTAGGGCAAAAATATGCCCTGATAGCCAGAACAGGT
AGAGATTCCTGGTACAAGCAGCGTGAGAGCCTTGACTTCATTTAATGGACACTTACTGAGGGACATGCTG
Sequence Type genomic DNA
Unitrap ID UNI79

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71012240..71012709 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es