Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15004C6
Clone ID IST15004C6
Vector VICTR78
Project tigm

Sequence tag IST15004C6HMF2
Sequence
CTCAGAGTCNTTAACATCCCTGAAAGCTATGTTTTTCTGGAATGCTAAAAAAAAAATGCTGTGAATTTTGAAAACTGTTT
ATTTTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40506733..40506819 83
NO GENE  


Sequence tag IST15004C6HMR1
Sequence
AGCACAGTCCTATTTTTATTCTTTCTTCTTGCCTTAAAGGACGAACCGCACCTTGCCTAGGTTGGTTGTTCACTCCTGTA
ACCCTTTGATGCCTTTGGACAAGGAAACTANAGAGGATCAGAAATTGCAGGTCTTTCTCTGAGCCCAAGGCCAGCCTGAG
GTTCGGACTGCCTAAAACCAACTCANTCCAGCCTTAGCTCTGTGTTCACGGGACAACCCTTACCTTCTTGCCTCCTAACT
TTACANATGTTTTAGTCTATTTTCTATAATACATGCTTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI4851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40506453..40506734 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042032 (Mat2b) NM_134017 methionine adenosyltransferase II, beta Gene [Source:MGI (curated);Acc:Mat2b-001]


Sequence tag IST15004C6BBF1
Sequence
CTGTCCACCTTAATGTCAAATGCTAAGAACAGAACTTGCAGAAACTAGGACTCTCTGAGTTTGGGATCATGCCAAAGATC
GTTCTACACACAGGCCAAATGCAGCCCCCACAGTGAAGTTATTCAGAGGCTACGGCTGGGTCCCGCGAGTGGCTAGGACC
TCAGGGGACCTCACACGTGGCCGCCGATTCCCATTCAGTCCTGTGAAAGCCCCACCACACCAGCTCGCGCTGCTGAGACC
CCTGCTTCTCCCCATTGTTGGCAGTGACCCTGTGCTCACCATGGCGCAACTTCGGAGCTTGCCTGAGCACAATCCACANC
ATCCAGCGGCAGGACAAGGAGCACAGCACACAGGCCCATTCAAGCTGGCTCANCTACTAAGTGAAACCCGCNCCACGGCA
ACCGGAANGCCCGCCTTCTCTTCTGACTGGCAGGTCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98302776..98303212 429

 
Come back to gene Mm.442230


For any suggestions or comments, please send an email to unitrap@crg.es