Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14535F3
Clone ID IST14535F3
Vector VICTR74
Project tigm

Sequence tag IST14535F3BBF1
Sequence
CCCACAGAAGGGACATGTCACCTGGGGTCAGGGTAAAACACATAAGGAATGCTGTGAGTCCTTGAGTTTATCATACTATC
ACATGATGTCATTAAGATTTGTTGTCATGAGAATTATTTTTGGTCAGGCATTGGTGACATACACCTTTAATCTCAGAGCT
TANAGTCAAGAGCAGGTAGAACCTCTCTGAGCTCCAGGACAGTCTGGTCTACNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28522908..28523119 210
 
EST/CDNA Est Name
  CR516120.1


Sequence tag IST14535F3HMR1
Sequence
TGGGTATAGCCTGAGGGAAGTGGGTGGAGTGGAGAAGCACAGGTATTGGCTATGTAGGTGGGCACAGTCGTCGTTTATGG
GGGGCTCGTGCANTCNGGTGCCTTGAGCATTTCCTTATGGCTTCCTTCCCACGCTGAGTCCTTTCCCTTCTGGTTTCCAT
CTTGAAAGCTTCCCCANTTTCACTCTCCTTGTGTTTGCTCTTTCAGGGGTCAGTGACATTTAGGGATGTNNCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI18002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28523116..28523351 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037640 (Zfp60) NM_009560 zinc finger protein 60 Gene [Source:MGI (curated);Acc:Zfp60-001]

 
Come back to gene ENSMUSG00000037640


For any suggestions or comments, please send an email to unitrap@crg.es