Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12443F4
Clone ID IST12443F4
Vector VICTR76
Project tigm

Sequence tag IST12443F4HMF1
Sequence
ACCAGTGCCACTATTACTCATTTAGAGATAGCTAGCCATACTGGTTATAACTTTTTTTATTGCTCATCAAATAAATCTCT
CAGTGAATGATTCACTTGGTTTTTTGTCTCCAAGTTTATTCCATCTTANCTTTCNAGACATANTTTTCCTGATTGTAAGA
TTAAATGGCTGTCATTTTCTTTCAGCACTGTATATCTGCCGTTTCTCTCCTTTCTTCCATCTCTTCCTTTCTTCCTTTCT
GTTGGAAGCCGACCCGCAGTTCACATGGACTGGGTTTCACCTGGGAGGCAAGCCGGGGCTGAAAAGANAGGGGAACTANA
CNGTCGAGAGAAAAATGGAGCTAANTANNANATGTGCTTATAAGGGGGTGGGGGTGGN
Sequence Type genomic DNA
Unitrap ID UNI32898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 25371118..25371494 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036611 (Eepd1) NM_026189 endonuclease/exonuclease/phosphatase family domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914734]

 
Come back to gene ENSMUSG00000036611


For any suggestions or comments, please send an email to unitrap@crg.es