Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10988H1
Clone ID IST10988H1
Vector VICTR76
Project tigm

Sequence tag IST10988H1HMF1
Sequence
ATCCCAGCACTTGGGAGGCAGAGGCAGGAGGATTTCTGAGTTCAAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAG
CCAGGGCTACACAGAGAAACCCTGTCTNAAAAAACNAN

Sequence Type genomic DNA
Unitrap ID UNI28981 UNI35451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 53369889..53370003 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 40979388..40979502 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119318702..119318816 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070327 (AL645911.14) Ring finger protein 213 Fragment [Source:UniProtKB/TrEMBL;Acc:B1ATE2]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42955301..42955415 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 104993919..104994033 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 70168656..70168770 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25389578..25389692 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064254 (Ethe1) NM_023154 ethylmalonic encephalopathy 1 Gene [Source:MGI (curated);Acc:Ethe1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130569239..130569353 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 122685082..122685196 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6974583..6974697 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 170024447..170024561 111
NO GENE  

 
Come back to gene ENSMUSG00000064254


For any suggestions or comments, please send an email to unitrap@crg.es