Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14165B4
Clone ID IST14165B4
Vector VICTR74
Project tigm

Sequence tag IST14165B4HMR1
Sequence
CTGGTTGTCGTGTTTTCTGGAGCTTTAAGGACCTTGGGGTCTCAAGCATGCCCTGCCCATTCCTTGTGGTCACCTCCTGT
TTATCGATGCAGTCACAGCACCTGCTGTGCCTTCCTGAGAGGGCTCCAGTGCGGTGCCTTATGCACACAAATATGCTTTG
GAATCGCTAAAAGCAAAAATCAGGAGGTCTGGGGTGGGGTCTGAGGANTTACATTTCCAACAAAGCCCCCCANGAGATGT
GANTGGCAACTGANAATACTTTCCNCNANNCANGTATATTACTACTTTTGAATTCTGCANAGGAGCTGGGAAATACTAAC
GTCNCGTGGTATANACTANGGCGTGCAAAAAAAAAAANTNNNAN
Sequence Type genomic DNA
Unitrap ID UNI2494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53707919..53708275 331
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]


Sequence tag IST14165B4BBF1
Sequence
CCAGAATGTCCCGGAAGGGAAGTCATCTACCAGGTTTATCCATCCTGGCTGTACAGTGGGGAGTAGGAATGAGAACCTGG
ATGCTGCGGATGCGACTCCTTTTACAGTAGTAAGCTGGAGCAGCAAGCAACACGGGAGGTGTGAGTGAGTGAGTGCCTGG
TCCCAACCACAGGCCGCCCGGGCTGACAAGGCCAAGTCCCCGCCCACTTCTGCTGTCACCCAGTCAAAACAAAGCCGCAG
TCTACAGTGCAGAGTCGCTCTCCCCTGCAGCCTGGAGATGCTGAGCCCCCTACAAGTGCTCTACAGCTGGATGCCCTGGG
TGCCTAAAGTCCCCAAAGAGGGAGAATGGCAAGAAAGCTGTCTTCAAACTGAGCAGACGCGCTCGCCGCCTGGGCTGTCA
CCCTGCCNGANCCTGTTTACACCCTAGCGGCCAGGANCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53707486..53707922 429
NO GENE  

 
Come back to gene ENSMUSG00000000708


For any suggestions or comments, please send an email to unitrap@crg.es