Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14635B7
Clone ID IST14635B7
Vector VICTR74
Project tigm

Sequence tag IST14635B7HMF1
Sequence
GGTTCTCTTCACAATACCAAGCCTCAACTCTTTTGCATGGTCCTTTCAGTCCTGGGTCTTCAAATGTCACTAAGGCTGTA
CCTTCAACGATGGCCTCTCCTAGCCTCTCACAGTGCCTAACCTCAGCTGCTCTCCATGACCCCTTCATAACTTCAAAATC
AGTCCACCTGGGTATCTCTTACACACTACCAATTCCAGCTGAAACATGAGCTACAACCTTGGCTATTAATGGAACACAGG
CTCCTTTGTGCTCTCTGAAAACACTTCCCAGATTTCACTTCAATGATGCTGGTCTCTTCTTAATCACCGTGAACTTCCTA
NCTCTAGCTAACCNNCATCAATTGTCCCAGTANTCTTGTCCCTTCTATTGACTAAAACCNGANCCNCATACATGGCCTAA
GCTGCCAACCAAGTTCTGCTGCTTACTANAGCTGAANAANGCCCNCTTCNTCTATTACATTATCANAANCTTTCTGTTTT
CCAAATCCCTTACTGCCNATGCTTGGCTGCNTTAAAACTTGCTCTGTNNNTGACCTTGANCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108506508..108507047 498
 
EST/CDNA Est Name
  CF895920.1


Sequence tag IST14635B7HMR1
Sequence
AACCTATTGATGAAGCCTAGTTGCAACGGAAGACACTTGTGTATTGGAGATACCAGTACCATCACCATGATCACCAAGAA
CAGCAGCAGCTGTGGAGTGAAGTCAGCCATAGCCTACCTAGCATGCTACAAAGATCATGTATGAATCCCAGACATTGGAA
CAAGAAGCTGTGAAGTTGAAGTTACATTGGAGACCCCAAGATGTTCGAGATGCCAAAGCCATAGGATATCTGCTGAGAAA
AACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507044..108507290 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


Sequence tag IST14635B7BBF1
Sequence
GGTTCTCTTCACAATACCAAGCCTCAACTCTTTTGCATGGTCCTTTCAGTCCTGGGTCTTCAAATGTCACTAAGGCTGTA
CCTTCAACGATGGCCTCTCCTAGCCTCTCACAGTGCCTAACCTCAGCTGCTCTCCATGACCCCTTCATAACTTCAAAATC
AGTCCACCTGGGTATCTCTTACACACTACCAATTCCAGCTGAAACATGAGCTACAACCTTGGCTATTAATGGAACACAGG
CTCCTTTGTGCTCTCTGAAAACACTTCCCAGATTTCACTTCAATGATGCTGGTCTCTTCTTAATCACCGTGAACTTCCTA
GCTCTAGCTAACCAGCATCAATTGTCCCAGTAGTCTTGTCCCTTCTATTGACTAAAACCAGANCNNCATACATGGCCTAA
GCTGCCAACCAAGTTCTGCTGCTTACTAGAGCTGAAGAANGCCCCCTTCTTCTATTACATTATCNNAANCTTTCTGTTTT
CCAATCCCTTACTGCCTATGCTTGGCTGCCTTAAAACNTGCTCTGTANANTNANCNTGAACTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108506505..108507047 513
 
EST/CDNA Est Name
  CF895920.1

 
Come back to gene CF895920.1


For any suggestions or comments, please send an email to unitrap@crg.es