Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14351B12
Clone ID IST14351B12
Vector VICTR74
Project tigm

Sequence tag IST14351B12HMF1
Sequence
ACTTGATCCTTTATGCAGGCCAGCTCTGGGCAGGTGTTCCTTTCATGGTCTTCTCCCCAGCCCTACCCTAGACCTCAGGA
TTCCAGTAGACTCTGGCAATGAAGGAATCTCAAAACACAACAGGTCTGCTAGCCACCAGCACCCCAGTGTTCCCTGTACA
TGCCAGTCAGGCCCTGGGTATGCTGTCCCCGCTACTCAGGAGGTTCATATAGAGAATCAAAAGTTCAAGGCCCATCTGGA
ATACAATGAGTTCAAATCCTGCCTAGCTGCAAAGTGAGACTCTGTCTCAAAAGAAGTGAAAATACACAGTTGGTGGGACA
GGCTATGGCTCNNAGTGCTCATCTAGTCTGCATGAATTCTGGGGTTCCATCCCCAGCACCCCATGAACCAGGCAGANCAG
TACATACTTATAATCCCAGCACCCAGCACCTGGAANGCNNGANGATCNNGANCTCAANNTCACCCCCNNANACNNGTGGA
NNTNNNCCTGANCTNNCANGTACNAACAANCNAGCNNGCANNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14351B12BBF1
Sequence
ACTTGATCCTTTATGCAGGCCAGCTCTGGGCAGGTGTTCCTTTCATGGTCTTCTCCCCAGCCCTACCCTANACCTCAGGA
TTCCAGTAAACTCTGGCAATGAAGGAATCTCAAAACACAACAGGTCTGCTAGCCACCAGCACCCCANTGTTCCCTGTACA
TGCCANTCAGGCCCTGGGTATGCTGTCCCCGCTACTCANGAGGTTCATATAGAGAATCAAAAGTTCANGGCCCATCTGGA
ATACAATGANTTNNAATCCNGCCTANCTGCAAANTGNNACTCTGTCNNNNANNANNTGAAAATACNNNNTTGGTGGGACA
NGCNNTNGCTCANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14351B12HMR1
Sequence
AAGTCNGTCCCTGANTTTCTCCATCTTCAAGGGAACACAAACGTCCCACCTCTGCCTGAGTTTACTACTTAGATCTTTGT
TGGAACTTACCTTGGGGATAAGACCAGACCTGTATAGCTATGGTAAGAAGG
Sequence Type genomic DNA
Unitrap ID UNI17299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21264291..21264421 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es