Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10087A9
Clone ID IST10087A9
Vector VICTR75
Project tigm

Sequence tag IST10087A9HMF1
Sequence
CTGAGGTTGCCCACATTTCATCACTTTATCTGTATTATCCCTTTAGGATGAGGCAAATGGACGTGTGGACAGCACACAGC
ACAGCAGCCAGGCCTGCCCTCACCTCCTAATGCTGGCGTACTGAAGGGGTGTTTAAGCGTTCATATGTTCCAGGCTTTCC
AAACTCCTCACTTAATGCTCGCAGCAGCCCTCGGTCCCTCTCTGAAAATAAAAACATCAAGGAGAGGATCAGATAGCTGA
GCCACGGCCTCAGAGTCAAAGCTGTCGATTCAAACCCAGGAGACTGCATAGCAGTGCTTCCCCCACTGCCTAAGGAAAAA
GGAAAAAATGTTGAGAGAAAAGCCTTTGGCTCTGCTGCTTGAGTGTTGGATGATTGACAGTTCATTTAGTCTGTCACATT
TGCATCCTGTGAAGCATGTGGCAGGCACACCCGTGTTTTCATTACCTGTGCCTTCCAGTTACCTGCGGTGCTGCATGGAC
GCTCAGATGTATGCTGGTATAAACAGGGGAGAAAAGCTTTCCTGTCTTCAGGGAACAAGGCCGTGTTCACAGAGCACAGA
AG
Sequence Type genomic DNA
Unitrap ID UNI8136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28085091..28085649 538
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]


Sequence tag IST10087A9BBR1
Sequence
TCAGACCTACCACACAGCAAGCACACACTTAACTGTGGCGACTGCTGCCACGTGTGTCTAATGGATCTCGGATTGCCAAG
GTCTACCATGAAAGACCCAGGATTGAGGCCTCACACCCCTGACATTCTGATTCTTGTTTACACTAGAAAATGCATGTGTG
TAAAATAGAATAAAGCGGCTCTGACACACCCTTCCAAGCAACCCCGCCTGAGACTCATTCACTCACTCACTCACTCATTC
ACTCACTCACTCATCCCAAACTTGTTTATGAAGCACCTATGACAAATACTGTTTGTGTTAGCAACCAGGCATGTGTTAGC
AACCAGGCATCTCCACCATCTGCCCCCAGGGATCCAGGGACAGCAGACGTCATCACTAGCTGCCAAGATGTGACACATTC
CCACTGTCACTATGAGATGCATAACCCCTGTGCTTGTGCTACATCCCCTTATAAAAGGCCAGTCCCTCCTCTCCCTGATC
CTTCTACCCTCCGCCCTTGCCCAGAGGCAGCCTCTGTAGACTCCCTCCCCATTAAACCTCCCATGTGAGATCCGTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28084539..28085094 552
NO GENE  

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es