Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST224-1
Clone ID PST224-1
Vector U3NeoSV1
Project escells

Sequence tag PST224-1
Sequence
CGGATTCTGAGTTCNAGGCAGCCTGGTCTACAAAGTGAGCTCCAGGACAGCCAGAGTTACACAGAGAAACCCTGTCTCAA
AAAACCAAAAAAAAAAAAAAAAAGATTTATTTATCTATTATATGTAAGTACATTGTAGCTGTCTTCAGACACTCCAGAAG
AGGGAGTCAGATCTCGTTACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCTGGACCGTTGGAAGAGCA
GTCGGGTGTTCTTACCCACTGAGCCATCTCACCAGCCCTTACAGGAGTTTTTTAAAGGTATATATTTAAAAACTTTCATT
AAAATGTTACTTTGTATATATGGGTGTTTTGCCTGCACATATGTCTGTGCACCACGTGCATGCCTGGTACCTTGCGAAGG
CCAGACGGATAGTGTCAGATTTACCTGGTACTACTG
Sequence Type genomic DNA
Unitrap ID UNI13590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 70181460..70181792 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022074 (Tnfrsf10b) NM_020275 tumor necrosis factor receptor superfamily, member 10b Gene [Source:MGI Symbol;Acc:MGI:1341090]

 
Come back to gene ENSMUSG00000022074


For any suggestions or comments, please send an email to unitrap@crg.es