Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1835-NR
Clone ID PST1835-NR
Vector U3NeoSV1
Project escells

Sequence tag PST1835-NR
Sequence
GCTTCCTCACCTGCTCTGGGACACCTAACTCAAGAGACCTCCCTTCTCCCCCTGCCGGCCCAATTATGTGCAGAGAACGA
TGTGGACAATGAGCTCTTGGACTACGAAGACGACGAGGTGGAGACAGCCGCTGGGGCANATGGGACCGAGGCTCCCGCCA
AGAAAGACGTCAAGGGCTCCTACGTCTCCATCCACAGCTCCGGCTTCCGAGATTTTCTACTCAAGCCAGAGCTGCTCCGG
GCCATCGTTGACTGTGGCTTTGAGCATCCATCAGAGGGTACATTTTATTGTTGGGTGTAGAGACCTTATTTAGCACCTCT
GGTGCAAGAAAAG
Sequence Type genomic DNA
Unitrap ID UNI5418

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35380120..35380451 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es