Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10228C3
Clone ID IST10228C3
Vector VICTR76
Project tigm

Sequence tag IST10228C3HMF1
Sequence
CTACTCGTCTCTTTCACCCACTCCATTGTATCAGGGATCTGGGCACTGCTGTGGTGAGTGAACAACCCGGGGTAAATGAG
ATGGCCGTGGGATCTTTCGCGGGGTGCTCGGACTGGGCTCCCTCTTGCTATTCCCATCACGGGTGAACAGACGCCAAGGA
TCTCACCTGATTCCGTTTGGAAAACTACCCAACCNANAACGGCTGTGGGAAACCCAAGGTACCTGGGCTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI35453

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77992506..77992738 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019437 (Tlcd1) NM_026708 TLC domain containing 1 Gene [Source:MGI (curated);Acc:Tlcd1-001]

 
Come back to gene ENSMUSG00000019437


For any suggestions or comments, please send an email to unitrap@crg.es