Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1761-1
Clone ID PST1761-1
Vector U3NeoSV1
Project escells

Sequence tag PST1761-1
Sequence
GAAGCCAAATATGAGCGCTCTGCCACCACCCCCAGGTGAGGAGCCCATACCCCCTATTCTTCAGTTGACCTTGGGGACCC
TCAGTGGGCAGGATCAGAGGGTTCAGAAGCTAGACTGAGGTGGGAGTTATGCAGAAAAGGCAGGAGGGCTGAGAACAAGG
ACTCCCCAATTCCAGTGATAGTTGGTGTGGGGGCTGGACCATAGGCCTCCTTATTCCCAGCCACCAGAAGAGCATGGATC
TTCAGGTACTGAGAGGAACGGGATTGCAGGGTGGGGTGAGCCAGCTGAGCTCGAGGAAGCCAGAGGCTCCCAGCCCGAGC
TTGGGCACACCACACCTTCTGTGGCGTATGGCCCNACATTTGTGTTGTCTGAGCATGCTTCCCAAAGTAGTGTCCCGGGA
TGCGCT
Sequence Type genomic DNA
Unitrap ID UNI8374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26470846..26471260 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007817 (Zmiz1) NM_183208 zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]

 
Come back to gene ENSMUSG00000007817


For any suggestions or comments, please send an email to unitrap@crg.es