Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14917D3
Clone ID IST14917D3
Vector VICTR76
Project tigm

Sequence tag IST14917D3HMR1
Sequence
TATGCAACATATACAAATAGGGGCTGAATGTGGCACAGTGGTTAGAGCACTGGCTGCTCTTACAGAGGACCAGGGTTCAA
TTCCCTAAAACCACATTGTGGCTGACAACCATCTGTAATGAGATTCGATGCCCTCTTCCGGTGTGTTTGAAGACAGCTAC
AGTGTACTCATATACATAAAATGAATAAATAAATCTTTTAAAAAATANTATTGAAAATTATATTTAATGTGTTTATATAT
TAACTTTATAAGGTCTGTATCTTTCACTAATTTTTAAAAATGTGGCCNGC
Sequence Type genomic DNA
Unitrap ID UNI17425

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57017648..57017934 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]


Sequence tag IST14917D3HMF1
Sequence
ATAGGAAAGCATACATTATACATGCAACACATATGTGTGAAAGCTTTCATATTTACGTATATGCACACTCTAGATTTTAA
TATGTATATGGATATATATACAACAGTGGGTATACCTGATACAGCTCTGTATAAATGCACATACAAGATTAAAGACACAG
CTGGGCAGTGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGACAGAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCT
GGTTTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACANANAAACCCTGTCTTGAAAAAAAACCNAAACCAAACAAACA
AACAAAAAGATTAAAGACACAAAATATGTGTAACACAGAAACAAAACTATTATCCATGTCTAATTACACACACATTAATG
CACATTTGATATGCAAAATGAAATCTTGTACTTGAGGAAACTGAGACNANACACAGAGTGACNANCAATTCNCACNTGAC
TAATGGTGGCGNGANNCTCCTANTGGNANGANCNNNCCTGAAGTGGANCNCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024209


For any suggestions or comments, please send an email to unitrap@crg.es