Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14473H11
Clone ID IST14473H11
Vector VICTR74
Project tigm

Sequence tag IST14473H11HMF1
Sequence
GATTACCCCCCCAAAACAGGTCAGAAAAGTGAGCAGAACGGCTTTGGAGGGCAGGGAGGACCAACCAGTAGCAGCAAGGG
CTCCTGGGAGGCGAGCGAGAAGTGTTGGACCCTGCAGAGCGGCTACCCACCTCTGCCAAACCAGCAGAACAAACTCCTCC
CGCGCCATGAGTTCCAGAGCTGCCCCTGGACTTCTGCATATTCACCTGAGAGCCACCTGGACACCGCCTACCACAGGCTG
TGGGGAAGGGCCCTGGANCANCAGNCAGGCCAGGAAAGGGGAAGCNNNNNNGAAANCCNANGGTGGGGGCTGANNGNNAT
CCTGGGANCGGNGATANAANGGNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14473H11BBF1
Sequence
GATTACCCCCCCAAAACAGGTCAGAAAAGTGAGCAGAACGGCTTTGGAGGGCAGGGAGGACCAACCAGTAGCAGCAAGGG
CTCCTGGGAGGCGAGCGAGAAGTGTTGGACCCTGCAGAGCGGCTACCCACCTCTGCCAAACCAGCAGAACAAACTCCTCC
CGCGCCATGAGTTCCAGAGCTGCCCCTGGACTTCTGCATATTCACCTGANAGCCNCCTGGACACCGCCTACCACAGGCTG
TGGGGAAGGGCCCTGGAGCAACAGACAGGCCAGGAAAGGGGAAGCCTAGAGGAAAGCCAAGGGTGGGGGCTGACTGGNAT
CT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148246586..148246906 315
NO GENE  


Sequence tag IST14473H11HMR1
Sequence
NCTTCATCNTGTTCTCTTACTCCCACAGTTCCTGGGACAGCTGGCAGCTGGTGGGCACCACCTGGCCCCTCCATTTGATA
GCTCAGGTTACTCTGTTTTGTCTCTCTACCCTTTAAAACAGCCTTGTAAATAAGCAAACACTCGGTGCCAAGCACCTTCG
GCATTTCGCCAGGCTGGTAAATATTTTAGTAGTGACTTGGTAACAGTTGTGCTCACTCTGATTCCCTCGGAAAGGTTCTT
GGTGATGGGGAAGGTCCGAGGCTCTGCNAAACGATCTGCCGGTTATTTATACTCCACTCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148246906..148247209 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es