Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13230C10
Clone ID IST13230C10
Vector VICTR74
Project tigm

Sequence tag IST13230C10HMF1
Sequence
ATGTGGAGGGCAGAAGAAAACCTGTGGGAGCTACTTCTCTCTGCCATGTGGATTTTGGGTCGGTCTTTAGGTTGTCAGTC
TTGACCGCAAGCCCCCCTACCTCCTGAGCCATGTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6057567..6057684 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es