Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10725B4
Clone ID IST10725B4
Vector VICTR76
Project tigm

Sequence tag IST10725B4HMR1
Sequence
CTAATCTTATGTGGGTAAGAGGTCTCTACACAGTAAGGTGAATCCTANNTCCTGGATTAGGATGCTACCTGGATACCTGA
TGCANAGTCCTTCCCCCAGGCTCCTGAGGTTGCATAGGCAGGGGACAAGATTCTGTGATCACACTGGAAGCCAGCCAGCC
CCCCTGGGCACTTACTTCCTGCCTTATAGCTCCCCTCTGAGGAGAAGCCTCCTTTGAAGTAGGCAAGAAGGTTTTACANA
NTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123376397..123376639 233
 
EST/CDNA Est Name
  AV086717.1


Sequence tag IST10725B4HMF1
Sequence
GAAGTTTCCGTTTGCGTGTATTGGAAGTTAGAGTTAAGACTTAAACACAGTTTTATGGGGAGGACTGTAATGCAGTCTAC
TACAGATGAAGTGGTTGTTTTGTTTGTTTTTCCAGGTGCANATAGGAATAGAGGGAGGGGTTCTGAGACCCGAATAAACT
GTCACCTGGTGCTCCCCAGAACAGCAGTTCTGGCCTTGTTACAGCCCCCTCATGAACCCCACTGTTGGAGCTCCAATCCT
AATGCCNGGCATTGCCTTCTTANTGCTGGTATTTTTAGTNATGGCATANGCTANGGGCTTCCANTGATTAACACCCCACT
CTGGGGAGCAATGGANGCCAAAGCTCTTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI11698

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123376044..123376397 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es