Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1562-1
Clone ID PST1562-1
Vector U3NeoSV1
Project escells

Sequence tag PST1562-1
Sequence
GCACGCAGAGACGCGGAAGATGCGGTGTACGGTCGCGACGGCTACGACTACGACGGCTACCGNCTGCGGGTANAGTTTCC
CCGAAGCGGCCGCGGGACCGGCCGAGGCGNCGGCGGGGGTGGAGGCGGCGGCGCCCCGAGAGGCCGCTATGGCCCGCCGT
CCAGGCGGTCCGAGAACAGAGTGGTTGTCTGCTGGTGAGTTGACTTCGTGCGGGTTAAAATCTTTTTCCCNNAAGACTGC
TTTGAGTACTGCAAGGTTTTTGTTATTGTTGTTTTTGTTTTGTTANACNACACGGGGTGCTTGGACTACTTCGGTNCTTT
GGGATGAATTTAGTAAATAAAGATTACTGTGGTGGTAANTTACCCAAATTAGGTTGCAAGTACTAGT
Sequence Type genomic DNA
Unitrap ID UNI14739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87861985..87862364 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018379 (Sfrs1) NM_173374 splicing factor, arginine/serine-rich 1 (ASF/SF2) Gene [Source:MGI (curated);Acc:Sfrs1-001]

 
Come back to gene ENSMUSG00000018379


For any suggestions or comments, please send an email to unitrap@crg.es