Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1454-1
Clone ID PST1454-1
Vector U3NeoSV1
Project escells

Sequence tag PST1454-1
Sequence
TAAGCTATATGGATTCCTGTCTTCAGGAGGAAAAAACAGGCAGACTTGAGATATTTCATGTCTTCTAGAAAGTGAGTCTC
TTCAGAAGGACCGACATGCTTGGACAAGAGTGCCGTTGTTTGGGGAAGAATGGGAATGTGGGGTAGGACAGGGAAGTGGA
TGTTTTGTTTGCCCACGTCTCAGGTGGCGGCCTGATCATCAAGATCCTGAAGCGCACAGCAGTGTTTGTGGAAGGGACGG
GTGAGGTNGGCCCACCGCTAGCACAGACCACAAAACTCAGTGTGCCCCGAAAGACCCGGCTGTATGTGGATCAGACCCTG
CGGGAGCGGGAAGCTGGCACAGGTGAGACCTAGGGAAGAACACAGAGTCCCACTGGGTGCCTGGGGCGTGAGTGAGATCT
TAGCCAGTGGGAAAGCCCTCAGG
Sequence Type genomic DNA
Unitrap ID UNI14900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4894180..4894601 417
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006464 (Bbs1) NM_001033128 Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]

 
Come back to gene ENSMUSG00000006464


For any suggestions or comments, please send an email to unitrap@crg.es