Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1447-1
Clone ID PST1447-1
Vector U3NeoSV1
Project escells

Sequence tag PST1447-1
Sequence
TGTCCCACAGACCTGGAAATGGCCGCCCCCAAAGGCCAAGGTATGGGTCCCCAGCTTCTCTTTTCAAACTTGTCTTNNNN
CACACACGAGCTCTCCAGCCTTGTAAAAGGTTCCTCTCAGGAAANNTTCTGTGCAANGGCAGACAGTCTTAAGTCTTAGA
AAGTGAAGCATCTGTCACATGGGGGTTTGGCCAAATCCAAATTACTTGGCCTTGAGCTTAGAACTTGAGTCTTTACGATC
TCTTGCTATGAATGAGGGTCACAGGGAAGAATCTTGGAAGCCAGCCTTCTTGGTTTCTTAGCTTGAA
Sequence Type genomic DNA
Unitrap ID UNI14831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102177396..102177702 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]

 
Come back to gene ENSMUSG00000020923


For any suggestions or comments, please send an email to unitrap@crg.es