Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10197H4
Clone ID IST10197H4
Vector VICTR76
Project tigm

Sequence tag IST10197H4HMF1
Sequence
ACGTGTACAGGATAATGCCTNATACAAATCAGATGTCCATTTGTTACTGTGTTTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI30919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727381..97727440 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32897693..32897752 56
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66347631..66347690 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]


Sequence tag IST10197H4BBF1
Sequence
ACGTGTACAGGATAATGCCTCATACAAATCAGATGTCCATTTGTTACTGTGTTTGTTAACAACCCTTTATCTCTTANTGT
TATAAACTCCACTTAAAACTGATTAAAGTCTCATTCTTGTAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727313..97727440 122
 
EST/CDNA Est Name
  AA450527.1 - DV073594.1

 
Come back to gene AA450527.1 - DV073594.1


For any suggestions or comments, please send an email to unitrap@crg.es