Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12050H5
Clone ID IST12050H5
Vector VICTR76
Project tigm

Sequence tag IST12050H5BBF1
Sequence
CCAGAATGGTAAGTTCTTCATAGCAACTGCTGGGCAGTTTTACAGAGTCCAAGATACTGGCGGGTTTCAGTTGAAGTGTA
ACTGATTACACAAGCTGAGGACCAGAGCTCCAGTATCCGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI1445

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84315740..84315863 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028487 (Bnc2) NM_172870 basonuclin 2 Gene [Source:MGI (curated);Acc:Bnc2-001]


Sequence tag IST12050H5HMF2
Sequence
CCACCAAAGCAGGGTGATACACCGTGAACAACCACCTCCCTAAAGCCCCGAGCAAAGCTTCTATCAAGTTCCAATTTCAC
CTAATGATCTATCTCAGTGGCCCAAGTGCTCACTGTGATCCAAGGACATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25032435..25032565 131
NO GENE  

 
Come back to gene ENSMUSG00000028487


For any suggestions or comments, please send an email to unitrap@crg.es