Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1331-NL
Clone ID PST1331-NL
Vector U3NeoSV1
Project escells

Sequence tag PST1331-NL
Sequence
GAATAAATGTAGTCGATGACATCACAAGTGGCAGAAGTCAGTCTGGGAACATCAAGTCACAATGCAGTGAATGGCTTTCT
TTTTGTCCCCCAGGGGAGGAAGCCTGAAGAAGAATGGCCAGCTCTAATTCTCAAGACATGGTCTGTGTAAGTTGGCATTT
TTCTCTTTGACATAGGGCAACCTTCAGGTTAGGTGACTCCTGCCCTCTTTCCCTCTTGAAGCTTCCCAAGGATCCNNATT
CCCCCAGCCCAGTCTGCCCCTTTCCAGTGAGGGCTGGCAGGTCTGAGCACTTCCTGTCTGTGCCTCTTCCCAGCTGGCAC
CGCGGTTGACTTTGAATGCGTTCCTCCACGTGTGCTCTCTGCTTGGTCTGTGCTCAGGNAGGACTGTCCCT
Sequence Type genomic DNA
Unitrap ID UNI15755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28477410..28477798 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057093 (C030039L03Rik) NM_198417 RIKEN cDNA C030039L03 gene Gene [Source:MGI Symbol;Acc:MGI:2148237]

 
Come back to gene ENSMUSG00000057093


For any suggestions or comments, please send an email to unitrap@crg.es