Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14705H1
Clone ID IST14705H1
Vector VICTR76
Project tigm

Sequence tag IST14705H1HMF1
Sequence
AACAGCAACAACAGTAACAGAAACAACAACAACAACAAAAACAACAACCACCAAACAAAACAAGAGATTAGCAACTATAA
CAATGTAAAATAGACGTTCTCAACCTATGTGTAACCATTCCCTTTAGGGGGTGGCTGCATATCGGACATCTTGCATAGCA
GATATTTACATTATGATTAGTAATAGTAGCAAAATTACAGTTATAAAGTAGCAACAAAATAATTTTATGATTAGGGGTTA
CCACAATGTACAGTTACCACAACTGTATTAAAAGGTGGTAGCATTAGGAAGGTTGAGAACTACCAATCTAAGGGTTTCCA
GCTTCCAGANACCTGGAAAGTCCTGGAATAACCCACTGAAAACAACAAACAAAAGATAACCTTACTGCAGTTCTGGGCTG
TCCCTGTAGTCTACCAACCGCCTGGGCCAATTGTTATTTGGGATCCTGGTTTTAACGCTGTCTTTGANACATTGTGTGTT
TAGTATCATTGCTGCAGNACAGANTTTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8515935..8516443 501
NO GENE  


Sequence tag IST14705H1BBF1
Sequence
AACAGCAACAACAGTAACAGAAACAACAACAACAACAAAAACAACAACCACCAAACAAAACAAGAGATTAGCAACTATAA
CAATGTAAAATAGACGTTCTCAACCTATGTGTAACCATTCCCTTTAGGGGGTGGCTGCATATCGGACATCTTGCATAGCA
GATATTTACATTATGATTAGTAATAGTAGCAAAATTACAGTTATAAAGTAGCAACAAAATAATTTTATGATTAGGGGTTA
CCACAATGTACAGTTACCACAACTGTATTAAAAGGTGGTAGCATTAGGAAGGTTGAGAACTACCAATCTAAGGGTTTCCA
GCTTCCAGAGACCTGGAAAGTCCTGGAATAACCCACTGAAAACAACAAACAAAAGATAACCTTACTGCAGTTCTGGGCTG
TCCCTGTAGTCTACCAACCGCCTGGGCCAATTGTTATTTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8515999..8516443 445
NO GENE  


Sequence tag IST14705H1HMR1
Sequence
GTTGTTTTATTTTTAAGAAAGCAATGCTAAGACAGCATGGCAGAGGTTGTGTGTGAATGGTTAATCCTGGAAGTTTTAGA
AATAAAAATTAGAGATAATAGAAATGTAAACTGAACACATGAACAAGAATATGTTAGTTCTGTAATAACAATTTTACTGC
AGTGTTGCTTTAAGAATCATTGTTCTTAGATGCAGACAAACTGCATCTTTTAATCCTTGCATCCNCCCNANGTATTTAAT
TTTAATCTTTAGTTTATGAAAGAAACTTAAATCTAAAAGAAATACNGCCTANGCATCTACATTTAATAAGACTATATATT
ATTTCNAGTCTATCTTACTANTTCAAAAGCNAACGCGCANGANAGAGCTGTGGGAAANCNNNGACTCCNTTGTGAGAATT
N
Sequence Type genomic DNA
Unitrap ID UNI27652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8516441..8516840 370
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027500 (Stmn2) NM_025285 stathmin-like 2 Gene [Source:MGI Symbol;Acc:MGI:98241]

 
Come back to gene ENSMUSG00000027500


For any suggestions or comments, please send an email to unitrap@crg.es