Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14949G5
Clone ID IST14949G5
Vector VICTR76
Project tigm

Sequence tag IST14949G5HMF2
Sequence
TCCGTAATATACCAAAGTCTTACTAGCGTTACTTGATGGGCAATCCTTTTTAATTAGAATGGGATGGAGGTGGGGGCTGG
CGCTGCATCATTACACTTCACCTAAGTACTGAAAATACATACAAAATATGATTTTCCTCCCCAAATCATCGTGACCCGCC
CATTTCTGCACACTCCTGCCCGCGCCTCCTGGGGAGCCCCTCTAAGTGTCAGCCCTGAGGACCGGCCAGGGGACCGTGGC
CCGTCAATTCNCTCCCTCCAAGGCGCTCAAACTTCNCCTCCCNNTCCCTTTCTTNNTCCCNGTTCCCTTTTGTGCCNNCT
CAAANNTCTCATTGAGGCGAGCGGCNGCCNCCGCNCCGTGGTAAACAANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14949G5HMR1
Sequence
CGGAGAAAGCCNAAAGGACCTTTTCACATTTTTGATTTATTTTCN
Sequence Type genomic DNA
Unitrap ID UNI1733

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81025891..81025934 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074794 (Arrdc3) NM_001042591 arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]

 
Come back to gene ENSMUSG00000074794


For any suggestions or comments, please send an email to unitrap@crg.es