Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1213-1
Clone ID PST1213-1
Vector U3NeoSV1
Project escells

Sequence tag PST1213-1
Sequence
AGGGCCACCTCCACCTTTTCCAGGTAAACTTTTTTAAGTTTATCATGGAGAAAAACATGTCTGCCTAATACCTTTTTTCC
TTTCTCTCTTTTTCAAGTAATGCATTATTAATAGACTCACTCTCCTTGTTATGCTATTTTTGGAACCCAGGAAATTTGAT
CAAGCATCTTGTTAAAGGAACTCGGCCTTTGTTCCTGGAAACTAGGATTCCATGGCATATGGGGCACAGCATAGAGGAAA
TACCCATTTTTGGCCTAAAAGGTCTTTATTTNTNTCCAAACTTGNAANACTTTATATATAGAATATTTACATCCGTCTTA
TTTTCTTACCTCTTAAAAAATNCNTTCAAGACCATTTTCCCTGTTTCACTTTCTAGCTTGGCATCAGAGTAGACTGTAAG
GTGGGTGAGAAATGNGTATGGGAAAGATGGAAACTCTAAGTGTTAAAG
Sequence Type genomic DNA
Unitrap ID UNI15756

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 116798642..116799092 419
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055531 (Cpsf6) NM_001013391 cleavage and polyadenylation specific factor 6 Gene [Source:MGI Symbol;Acc:MGI:1913948]

 
Come back to gene ENSMUSG00000055531


For any suggestions or comments, please send an email to unitrap@crg.es