Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13780G9
Clone ID IST13780G9
Vector VICTR74
Project tigm

Sequence tag IST13780G9HMF1
Sequence
GTGTATGGTCTGACCTAATGTCCCCCATTCTCATGCTAACTGGAAATGGTAAGAGTGTAGCCTGGAGCTGTAGTGCCGTC
TGTGGGTTGACGTGCTTGCAATGAAGTGTCTGCCCTGCTACAGCTCACAGGCATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI5311

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96833842..96833980 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018678 (Sp2) NM_030220 Sp2 transcription factor Gene [Source:MGI (curated);Acc:Sp2-001]

 
Come back to gene ENSMUSG00000018678


For any suggestions or comments, please send an email to unitrap@crg.es