Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14095F9
Clone ID IST14095F9
Vector VICTR74
Project tigm

Sequence tag IST14095F9HMF1
Sequence
CCATTGAATTGAAGGTGGTGATGGGGATGAGCAGGTCAAGGGAAGGGTGGGGCGAGGAAGCCTGGTTGTTCAGCTGGTGC
CNAAGGCAGCACTGAAGTCTCTTCCGTGAACCTGGAGGGAGGGCGGGCGANCCAGANAGGTGCAAGN
Sequence Type genomic DNA
Unitrap ID UNI30424

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97255000..97255145 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038485 (Socs7) NM_138657 suppressor of cytokine signaling 4 Gene [Source:MGI (curated);Acc:Socs7-001]

 
Come back to gene ENSMUSG00000038485


For any suggestions or comments, please send an email to unitrap@crg.es