Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14935B6
Clone ID IST14935B6
Vector VICTR76
Project tigm

Sequence tag IST14935B6HMF2
Sequence
CCNGTTAATCTGAATTNNGANCANGTANCTANTAANCTTTACTCAGTCCGTGATCAAAATTANATACTTACAAAATGAAT
TTCTGTCAAGTCACAAAAATTTATTTTTGCAAAAATTACTTAGTGCAGGAGGCTTTTCAAAAACCCATTTAGTGCGAATT
CAATCAAGATGAATGAGATAAACCTGATTTCTAATCGTATTTCATAAACCTGATTCTTAAAGTCATATTTTACAAACCTG
ATTTCTAAAATTGCATTGAACCATGTTTTACTAGGCTCTGTGTAAATAGCAGGCAATGTCTGCTGAGGAATTGTTCTTCT
TTTATTTTTGGATTTACTGGGAAAGCTGCAAATATAACTTGCTAATACACTTACTTATCAAGACAGATCAGTTAAGGCCA
AATTACCTTGCTGCTTAACANANACTGGCAAGANGAAATNNAATAGTGTCACTTTGTTTTTAGTATGACATATGATGGTG
GGGACTGGCNACNGAANGANGGTTTNCCNCNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 47095413..47095920 468
NO GENE  


Sequence tag IST14935B6HMR1
Sequence
ACATTGGGTGAAAATCATGCCCCAATCACTGAATAGAATCAGTGAAGTTGCTTGCAAGGAGACAACACCACTATAGAACT
CCTAACAAGTATGTAATCTTACAGCAGCGCTCTGATTGGAAGGCGTGTCTCGATCTGGTTTCTTACAAAAGCCCGAGAAG
GAAATTATTTGTGCAGTTATTGCTAGTGTTATATGATTTGCTATTTAAAAACTACCACTAAAAGTAAGGCANTTAAAACA
CAAATGTANTTTGTATTTATGCGTGTGGAACAAAGTANTCNNCTGATTGAAACATGGCTTAACATGTGATATTAGTGTAN
AACANTNACTCCTTTCTTGGGGTGGTGCCAATTAAAGAACATTACAATGANCTATATATTTGTAACGTTTTGTANTGCCG
GAAGTGACACTNNNTNCNATTNCNCTTCCTGCTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI29617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 16084330..16084768 405
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047213 (Ythdf3) NM_172677 YTH domain family 3 Gene [Source:MGI Symbol;Acc:MGI:1918850]

 
Come back to gene ENSMUSG00000047213


For any suggestions or comments, please send an email to unitrap@crg.es