Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10046F9
Clone ID IST10046F9
Vector VICTR75
Project tigm

Sequence tag IST10046F9HMR1
Sequence
CTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCGCTCTCGCTCTTTTTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15519877..15519936 60
NO GENE  


Sequence tag IST10046F9BBF2
Sequence
CTAGATGGTTCGATTAGTCTTTCGCCCCTATACCCAGGTCGGACGACCGATTTGCACGTCAGGACCGCTACGGACCTCCA
CCAGAGTTTCCTCTGGCTTCGCCCTGCCCAGGCATAGTTCACCATCTTTCGGGTCCTAACGCGTACGCTCGTGCTCCACC
TCCCCGGCGCGGCGGGCGAGACGGGCCGGTGGTGCGCCCTCGGCGGACTGGAGAGGCCTCGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391465..57391690 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]

 
Come back to gene ENSMUSG00000075007


For any suggestions or comments, please send an email to unitrap@crg.es