Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12035C11
Clone ID IST12035C11
Vector VICTR76
Project tigm

Sequence tag IST12035C11HMF1
Sequence
CATCGCTTATTATCTGATTTCTGTTGCTATAATGTGATGTCTGACGGGATACTTGATAGGA
Sequence Type genomic DNA
Unitrap ID UNI34909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25653984..25654044 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es