Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13519F5
Clone ID IST13519F5
Vector VICTR74
Project tigm

Sequence tag IST13519F5BBF1
Sequence
GTATTCTGTTGCTGATGCTCAAATCTATGGTTCCANATTTCTTTCCTAGGGTTTCTATCTCCAGTGTTGCCTCACTTTGA
GTTTTCTTTATTGTTTCTACTTCCCTTTTTANGTCTAGTATGGTTTTGTTCATTTCCATCACCTGTTTGTATGTTTTTTC
CTCTTTTTCTGTAANGACTTCTACCTGTTTGATTGTGTTTTCNNGTTNTTCTTTAANGACNTN
Sequence Type genomic DNA
Unitrap ID UNI15268 UNI31996 UNI32698 UNI35464

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 65211..65430 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 45817..46036 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079194 (AC133103.5-209) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UT50]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166392: 93737..93956 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161913: 56848..57067 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161898: 9689..9908 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166417: 393323..393542 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166383: 335635..335854 206
 
EST/CDNA Est Name
  CA584285.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165796: 457284..457503 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166370: 422172..422391 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166420: 79615..79834 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166344: 521243..521462 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166347: 733884..734103 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161897: 120417..120636 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161866: 924119..924338 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 430791..431010 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 48305536..48305755 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063434 (Sorcs3) NM_025696 sortilin-related VPS10 domain containing receptor 3 Gene [Source:MGI Symbol;Acc:MGI:1913923]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 22729278..22729497 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 16530622..16530841 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15750897..15751116 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022672 (Prkdc) NM_011159 protein kinase, DNA activated, catalytic polypeptide Gene [Source:MGI Symbol;Acc:MGI:104779]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 10741515..10741734 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 19156386..19156605 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021314 (Amph) NM_175007 amphiphysin Gene [Source:MGI Symbol;Acc:MGI:103574]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 15383791..15384010 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 10948074..10948293 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 25565021..25565240 206
 
EST/CDNA Est Name
  AI645701.1 - AI426759.1 - AI561760.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 11327506..11327725 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20368342..20368561 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 29550025..29550244 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18117594..18117813 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 23946697..23946916 206
 
EST/CDNA Est Name
  CA557250.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7620630..7620849 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8586748..8586967 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 6422035..6422254 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 9172182..9172401 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 39546372..39546591 206
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 17283870..17284089 206
NO GENE  


Sequence tag IST13519F5HMF1
Sequence
GTATTCTGTTGCTGATGCTCAAATCTATGGTTCCAGATTTCTTTCCTAGGGTTTCTATCTCCAGTGTTGCCTCACTTTGA
GTTTTCTTTATTGTTTCTACTTCCCTTTTTAGGTCTAGTATGGTTTTGTTCATTTCCATCACCTGTTTGTATGTTTTTTC
CTCTTTTTCTGTAAGGACTTCTACCTGTTTGATTGTGTTTTCCTGTTTTTCTTTAAGGACTTGTAACTCTTTANCAGTGT
TCTCCTGTATTTCTTTAAGTGATTTATTAAAGTCCTTCTTGATGTCCTCTACCATCATCATGANATATGCTTTTAAATCT
AGGTCTAGGTTTTCGGGTGTGTTGGGGTGTCCTGGACTGGNNNAANTGGGANTGCTGTGTTCNGATNATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41763279..41763667 371
NO GENE  

 
Come back to gene CA557250.1


For any suggestions or comments, please send an email to unitrap@crg.es