Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14591F8
Clone ID IST14591F8
Vector VICTR74
Project tigm

Sequence tag IST14591F8BBF1
Sequence
GTTTTATTTATTTATAGAAATGTTGGTTGAGCCTACTGGATGCAAAGCAGTGGGCCCAGGGAAAAACAGATGAACATGAC
CTCAGTGAACCATTACAAAATGAAACACAAGCAGCTGAACACAGAATAGCATTTTATCCTGATCATCTCAGANAGGCCTC
TGAGCAACTTGAAAGCCATCCTAGGGTTTTAGGTCACTTATTCATTTTACAAGTAATTACTAACTCTGTCTTAGATACTA
GGATTAGAGTCACAAACACAAAAAAAGGGAACTAAGTAAACTTTTTGATATATGAGAAAAATTAAGAACGATGAGGTNGA
ATCAGAAAACTGGGCATGCAAGAGTGGCAGGGGTCANGGAAAGATGCCTGGGGAGCCCCATGACTGCAGTGACTNNGACA
GGAGANAGCNNGGTCANATGTTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14367123..14367546 406
NO GENE  


Sequence tag IST14591F8HMR1
Sequence
AAACGAAATTAAGTCTACTTATTTAATTAGAGACATGGTTTCCTGAATATTCCTGGATGGTCTGAAATTTGATGTGTAGA
CTAGGCTAGCCTCCAATTCATAGGCTGCCTGCCTCTACCTCTCAAGTGTTGGGATTCAAGGTATATGGCACCATGTCTGA
CTTTCTGTTGTTTTGTTTATTGAGACAGTCTTGCTTTGTAGCTCGGGCTAGCCTGGAACTTACTACCTTCCTTCCC
Sequence Type genomic DNA
Unitrap ID UNI24559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14367543..14367777 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023088 (Abcc1) NM_008576 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 Gene [Source:MGI (curated);Acc:Abcc1-001]

 
Come back to gene ENSMUSG00000023088


For any suggestions or comments, please send an email to unitrap@crg.es