Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10077E1
Clone ID IST10077E1
Vector VICTR75
Project tigm

Sequence tag IST10077E1BBF2
Sequence
TTCATGAACTAATGGCACTAATACCAAATCCTTTTCTACAGCACTTGAACCCAGGGCCTTGCACTTGCTAAGCAAGCGCT
CTACCACTGAGCTAAACCTCCAACAGCTCTTTTTAAATGTTCTTTCTTCCTGTTCTATACGTACAAGGGCCTTCTGCATA
TTCCATTCTTACTCTAATCACCTAACTCATTTGGTCATATTCTCTTTTTGTAATTTATTATTACGTTTGGTATGTCTGTC
ATGTGAATCGAAACATACATGTGGTAGTCAAAGGGTAACTTTGTGGTGTGAATTCTCTTCTTCCACCTTATGTGGTTTCT
ATTTATCAAGCTCAGGTTATTAAGCTTATGCTGTAAGTGCTTCATCCACTGAGCCATCTCACCAGACCAGTGTTAATATC
TTTGTTGTTGTTTGTTTGTTATCAAGGCAGGGTTTCTCTTGTGTACCCTGGCTATTCTGGACGTCACTCTGTAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94886859..94887331 447
 
EST/CDNA Est Name
  CN530067.1 - BE368026.1 - BY330982.1 - BI734621.1 - CK619306.1 - DT906130.1 - DT910964.1 - DT927930.1 - BG078098.2 - BI665835.1 - BU918605.1 - CX239027.1 - AW230008.1 - CA535608.1 - BY743812.1 - BY744684.1 - CA534620.1 - CN679885.1 - CN673442.1 - CN682735


Sequence tag IST10077E1BBR1
Sequence
CAGTTTCCCCAGAAGAGGAGAGGAGGGTATTACCCCCTCCTCAGTGTCACTTATGAACGTAAAACAGGCACTGACTCAGT
TTCCCCTGGCAAAGGAATGCCTCTGTGTCCCCTTTCTCTAGTTCCCCGGCCTCTGTCAGGGCAGGTTTCAGGGTCTTGGC
TCAGTTTTCTTGGAAGGGAGGGAGCTTGGCTCTGTCAGGCCTTCGCAGGTGAGGGTGGGCACTGGAGTTTATTGACAATG
TGCCTTGTCTTTCCCTTTCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI23595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5638171..5638434 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024927 (Rela) NM_009045 v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene [Source:MGI (curated);Acc:Rela-001]

 
Come back to gene ENSMUSG00000024927


For any suggestions or comments, please send an email to unitrap@crg.es