Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10873H7
Clone ID IST10873H7
Vector VICTR76
Project tigm

Sequence tag IST10873H7BBF1
Sequence
AAAGATGGAAAAAAGCAATTGGGTTGAGCAGGTGGTATGTGACCAAGGACAACTGAAGAGTAGCCAAGCTTANGGTACTG
TGTATCCCCTCTATTCTTAGGTGCACCGTCCCTGGAGGAGGTGGGTTCTTCTGGGAAATGCGTTTACTATGAGGGTGCTT
GCAAGGAGCTCAGAGTCCAAGACAAAATGGTCTTAAAATGTGGCTGTCACTTGTGAATAAGGAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117053813..117054040 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST10873H7HMR1
Sequence
CTTTGAATAACTAAAAAAGCCTCACATCTAAAATATTTAGTGTATTTCTATCCCAGATATGTTTCTTTGTTGCCTTAGCT
CTTTATATCTTTTAAATTAAAGTAATTAATTGATCTTTTTTTTTTTTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117054037..117054165 129
NO GENE  

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es