Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0284
Clone ID AD0284
Vector pGT0lxr
Project sanger

Sequence tag AD0284
Sequence
CACTGCCTTCCTTGCCGATGACGTCTTGGCTCATGCTACCTGATGGTATCACTGTGGAAGTCATCGTGGTCAACCAGGTC
AATGCTGGGCACCTATTTGTCCAGCAGCACACACACACCCCACCTTCCACGCACTGCGCAGTCTGGACCAGCAGATGTAC
CTCTGTTACTCTCAGCCTGGAATCCCCACCTTGCCCACCCCAGTGGAAATCACGGTTATCTGCGCTGCCCCTGGTGCGGA
CGGGGCCTGGTGGAGAGCCCAAGTAGTGGCTTCCTATGAGGAGACCAATGAGGTGGAGATTCGCTACGTGGACTATGGTG
GATATAAGAGGGTGAAAGTCGACGTGCTCCGGCAAATTAGGTCTGACTTTGTGACCCTGCCATTCCAAGGAGCAGAAGTC
CTTCTGGACAGCGTGGTTCCTCTGTCAGATGATGATCATTTTTCACCGGAGGCAGACGCAGCCATGAGTGAGATGACAGG
CAATACAGCACTGTTGGCCCAG
Sequence Type mRNA
Unitrap ID UNI2197

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88694456..88700272 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018428 (Akap1) NM_009648 A kinase (PRKA) anchor protein 1 Gene [Source:MGI (curated);Acc:Akap1-002]

 
Come back to gene ENSMUSG00000018428


For any suggestions or comments, please send an email to unitrap@crg.es