Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10456A6
Clone ID IST10456A6
Vector VICTR76
Project tigm

Sequence tag IST10456A6HMR1
Sequence
AATGACTGCTTATGAANAGACTGGATGAGGATAAAAATGGTAGTTGGTTCTGGGTTTGGCCTCTGCTGCCTGGCCCATGG
TTACAGGGTGTTGTCGAGGTAGCTCCGTCATGCTGTGGTTTTCCTCAGTTTTACATGGGGTCCACTAGTTTTTTGTTTTT
TTGTTTTTTTCTGCCNNCANAATTGTTTCCAAGAGCCTGTGTGGGGGCTATGTAAGGAATANATGGAATATTTTGCATCC
NGGGGTTCTGTGNAGCCCCNGTTGN
Sequence Type genomic DNA
Unitrap ID UNI29501

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35300541..35300804 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024393 (Bat2) NM_020027 HLA-B associated transcript 2 Gene [Source:MGI Symbol;Acc:MGI:1915467]


Sequence tag IST10456A6BBF1
Sequence
AATGGTAGGCCAGGTGGAGTTAAGCACAGACCTAAAGGAGCGAAGGAAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI11447

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21656281..21656336 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032198 (Dock6) NM_177030 dedicator of cytokinesis 6 Gene [Source:MGI Symbol;Acc:MGI:1914789]

 
Come back to gene ENSMUSG00000032198


For any suggestions or comments, please send an email to unitrap@crg.es