Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15051E4
Clone ID IST15051E4
Vector VICTR80
Project tigm

Sequence tag IST15051E4BBF1
Sequence
TAAAGAATTCTGAACAGTCAGTGCAGTTATAAGTATCTGACTGCTATTAAGCATTAGTATTCTCTCAGATGCAAGCAATA
AAGCAACTATTAATGATGGATGTGATTATTAATAACTGATGATTAACAGAAATGGATCTAAAGAAATTTAAATTGCTATG
AACAATTTGGTTCAACATAAACTCTGGGCCAAACAAAGTTTCTTTTGTTCAATAAATGTTTATTGCTTTTTCAATTATTC
TATTTACAAACAACATGGAATTTCTTGGCCTCATGATACAAAGCAATACTGTAGTCTAGCAGTGTAGGCAACATCATGGG
AACCAGAAAAAAGGCCAGGCCTTTTGCACCAGCCAACATTTTCCAGTTGAAAATACTAATTTACACATATAGAACACTTA
TAAAATGCACTTGCATGTAAACACTGNAAAATCCTGNNNTTTAAAACTCTATACCTCNNNAACTCTAAGTACATANAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10402846..10403325 460
 
EST/CDNA Est Name
  BB249866.1 - DV651716.1 - CB840818.1 - BU923614.1 - AA542006.1 - BE848561.1 - CK020709.1 - CD772640.1 - DR754528.1 - CN697675.1 - CK633936.1 - CK634501.1 - CK634458.1 - CD771018.1 - AW762220.1 - BF452755.1 - BF020819.1 - BE686348.1 - BU756451.1 - CR514232


Sequence tag IST15051E4HMF1
Sequence
TAAAGAATTCTGAACAGTCAGTGCAGTTATAAGTATCTGACTGCTATTAAGCATTAGTATTCTCTCAGATGCAAGCAATA
AAGCAACTATTAATGATGGATGTGATTATTAATAACTGATGATTAACAGAAATGGATCTAAAGAAATTTAAATTGCTATG
AACAATTTGGTTCAACATAAACTCTGGGCCAAACAAAGTTTCTTTTGTTCAATAAATGTTTATTGCTTTTTCAATTATTC
TATTTACAAACAACATGGAATTTCTTGGCCTCATGATACAAAGCAATACTGTAGTCTAGCAGTGTAGGCAACATCATGGG
AACCAGAAAAAAGGCCAGGCCTTTTGCACCAGCCAACATTTTCCAGTTGAAAATACTAATTTACACATATAGAACACTTA
TAAAATGCACTTGCATGTNAACACTGNAAAATCCTGNNNTTTAAAACTCTATACCTCAAAGAACTCTNAGTNCATANNAA
ATNGAAGANNTTCTANCTGATACCAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10402846..10403352 477
 
EST/CDNA Est Name
  BB249866.1 - DV651716.1 - CB840818.1 - BU923614.1 - AA542006.1 - BE848561.1 - CK020709.1 - CD772640.1 - DR754528.1 - CF729830.1 - CN697675.1 - CK633936.1 - CK634501.1 - CK634458.1 - CD771018.1 - CN456098.1 - AW762220.1 - BF452755.1 - BF020819.1 - BE686348


Sequence tag IST15051E4HMR1
Sequence
TTTATACNNAACCTGTTNNTCATTGTTTCCNATTTCCTTCATTGACTGCTACTAACTATTAGTTGTTAGCTGTATTTTAT
TTCTATTTTTTTCTTTTAACAAGTCGGGTTTTTCAAATTATTTTTTGTGGGAGTGGGCTCTTCTTCATTTGTTCAAATCA
TGATATGAAATTGTCATGATTTTTATTGTATTCTGTANATGGTGTCAATCAGTTTGTCAGAATTCAACATGCCTTTTTTT
TATTANTTGTGATTAGTTTTCATGTTGTCATTAAGCTGTCACTAGCTGAAACTAATCTCTTCTCTATCTTTTCTTTTCTT
TTTTTGTTTTGTTTTTTGTTTCTAACCACCCAGCCGCCACCGGCAACTAACCTATGACCTTCTGACCTCTGAACTCTTCA
CCCAATGATGACCTGACCANGCCTGCCTGCTGANCAGTTN
Sequence Type genomic DNA
Unitrap ID UNI28025

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10402411..10402849 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062078 (Qk) NM_021881 quaking Gene [Source:MGI Symbol;Acc:MGI:97837]

 
Come back to gene ENSMUSG00000062078


For any suggestions or comments, please send an email to unitrap@crg.es