Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14546H7
Clone ID IST14546H7
Vector VICTR74
Project tigm

Sequence tag IST14546H7HMF1
Sequence
TTATAATTCTGCAATCTTGCTTCCAGATATTAATACAACTAATCATAANNTNTAANNNNCTACAAAAACCTGAACACAGC
C
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14546H7HMR1
Sequence
TAAAATNNTGCTGTGATTTGTAAGCAACTGCTAGACTATTGTATGAAGTGGCCTGATTTGTTCCAGTCGCCATCACAATG
AATGAAAGTTCCATTCCTCTTCTTTCCCAGCAATTCATCTTTCTACTTTTTTTGAATTTTAGCCATTCTCAGTGTTTTTT
TTAAAGGCTCCTTGATTGTTAAATGTGTTGAACATTGTTTTAATGCTCTACCACTGANCTTGGTCCCCANCCTGAGTATT
GGTTACATATGTCCATTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI35466

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7447736..7447997 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031154 (Otud5) NM_138604 OTU domain containing 5 Gene [Source:MGI (curated);Acc:Otud5-003]

 
Come back to gene ENSMUSG00000031154


For any suggestions or comments, please send an email to unitrap@crg.es