Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10080D5
Clone ID IST10080D5
Vector VICTR75
Project tigm

Sequence tag IST10080D5BBF1
Sequence
CTTCCAACTTTTTAGACAGCGGTTCCTTTAAGTGCGCCGCTCTGTGTCGGGTGAGGCCTTGAGACTTTGCGTCCCACTGT
AGCCAATGACGTCTTCGACTTCCGCTTTTCTGCACGTGGCCCCGCCTCTTCCGGGTTGCGGTAGAACATGGCGCAGGGAC
AACGCAAGTTCCAGGCGCAGAAACCTAAAAGCAAGGCTGCCGCGGCGGAGCGGAGCCGCGGGCCTCGGAAAGGCGGTAAG
GAATGAGGTGGGGAGCAGGGAGAGAGGATGGCGGACTTGAGGTGGCCCGCCGAGGCTCACCGGCTGGTGTCTCTCCCCCA
GGTCGAGTCATCGCTCCCAAGAAAGCGCGCGTTGTTCAGCAGCAGAAGTTGAAGAATGTGAGTGAAGCGATGCAAGTGAT
CCGGGATGACGGACGGACAGCCGAAAGGGTTCCCACTGCAAGCTATGTCCTCCGCTAGTGATGAATCT
Sequence Type genomic DNA
Unitrap ID UNI20785

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86773279..86773749 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019362 (D8Ertd738e) NM_001007571 Leydig cell tumor 10 kDa protein homolog [Source:UniProtKB/Swiss-Prot;Acc:Q8R1F0]


Sequence tag IST10080D5BBR1
Sequence
GAAGGAAAATTAATTACCATTTTCAGGGGTGGGACCACATTTGTGTATTGTAAAACATGCGCGTTTTAAAAAAATGATTT
ATTTATTTCATTTATATGAGTACACTGTAGTCTGTCTTCAGACACTCTAGAAGAGGGCATCGGATTCCATTACAGATGTT
TGTGAGCCACTATGTGGTTGCTGGGAATTGAACTCAGGACCTCTCCAAGCACAAGCAGTCAGTGCTCTTTTTTATACATA
AAACTTCAAATAAAGCTTGGAGTCTGGTAAACGAGGAGCTCGTTTTTGGAGGAAAATTAAAGGAGTGTCAAAAACGTTCA
GTAATCATTGGTGATGTGACTTGGTGGGTAAAGATGCTTGCTGCCATGCTTATTTGAGTTTGATCCTGGGTGGTGGCACA
GGCATTTAATATCAGCACTTGGGAGGCAGCGAACTGACTCCCATAGATCACTTCCACCAGAATAAACCAGAATAAAGATA
TCACTAAAAAAAAAAATCCCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86773746..86774247 498
NO GENE  

 
Come back to gene ENSMUSG00000019362


For any suggestions or comments, please send an email to unitrap@crg.es