Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14265G11
Clone ID IST14265G11
Vector VICTR74
Project tigm

Sequence tag IST14265G11HMR1
Sequence
GGTNANNCAGGCCAGACACTGTCTTCAGTTGTCTCCAGANACTAAACCCACAAGTCTTTCCTGAAGCCCACTGCTGGATT
CAGTACTCTTGACTGAAATTTGACCTTAGGTTTTTCTGCTTTTCTC
Sequence Type genomic DNA
Unitrap ID UNI10643

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77802796..77802921 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032349 (Elovl5) NM_134255 ELOVL family member 5, elongation of long chain fatty acids (yeast) Gene [Source:MGI (curated);Acc:Elovl5-001]


Sequence tag IST14265G11HMF2
Sequence
ACCTGTCTAAACTGCTCTGCCGTGGAGGCCTGCAGGAGCTGCCTCACATGGGGGTCCCTCTTCAAACGCACACCCAGGAG
GAGACTTTGCCAGAGGGCCACATTTGTTCTTTCGGTGCCTTCCTTCTCAGCTGCACCACTCTCCTCCTGGGTTTGCAGAA
CTTTTCTCAATCAAACTTAGGAACAGTGGAAAAAGCCAACAGTCTTTGGAGAGCAGACATGGCGAGAGTCAAGAGGGATC
TATGCCACGGATGGGCTCGCTGCCCCAGTGATGAAGTGGGGGTTGAGCCNTGACTCANCNNGCTGATTCTGACAAGGCAN
GTATCTTCCCCCACGCNNNNNCNCACANCTGAGTGTGTCTATNCNCTCTTTACAGCTACGGCTGCNGCTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77802408..77802798 361
NO GENE  


Sequence tag IST14265G11BBF1
Sequence
GCATCACTACAAGATAGTACACCTTTGTGGATCTGCAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI25955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9371483..9371527 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44202277..44202321 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31163367..31163411 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029166 (Mapre3) NM_133350 microtubule-associated protein, RP/EB family, member 3 Gene [Source:MGI (curated);Acc:Mapre3-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108559030..108559074 43
NO GENE  

 
Come back to gene ENSMUSG00000029166


For any suggestions or comments, please send an email to unitrap@crg.es