Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12858H9
Clone ID IST12858H9
Vector VICTR76
Project tigm

Sequence tag IST12858H9HMF2
Sequence
CTTCCCCTCCCTTGTGCTCCTGGGAGTGGTTTCCTGGATGCTGGCCCTAAGTTTTGCATCTTGTTTTCNNCACTTTTTGA
ATTAATTGTCGTTTTGAAAGGTTTCTGCACTTTTCCTTCTCCCAGGTTTCTCGGACACCGAGGAGATCAGGGATGAGACA
CACAGGGCTACGTCTGTTTCCATACCAGACACACATGCCTTAAGCACAGCTCTGTCCTTCAGAGCCACTGGGTCTTCTGT
AGGGCCTGGGGCGGCTAGAACTGGAAACTGCNNGCTACTCATGCTGCTGTGGGTTCACTGTGGGACTGTGGAACTCCCAC
CCAGGAGTCATGGTAAATGCGACAGCAATTAAAACACCCACGTGAGACACAGTGGGCAGAGATCCACCTCCNAACAGANG
AAGCCCAGCGCTAGACCATTGTAAACCAACATTCCGTCTACGTTCATCNNTNAN
Sequence Type genomic DNA
Unitrap ID UNI15985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66511012..66511459 430
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST12858H9BBF1
Sequence
GTATGGAGAGGAAGAACACACCAGAGNCTGCGTTAGGAGAATCCACCATCACCTCCCAGCCACCTCCCTTGACCTCTTCC
TCTCGCTCCTCCTCCTTCTCCCAACCTAGCCTTGACCTGGAGGTGCATGGAGGAAAGAAGACCCTAACAAGGCTTTGTGA
TCAGTGATCCTGCCAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI15445

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 36277844..36278024 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060275 (Nrg2) neuregulin 2 Gene [Source:MGI (curated);Acc:Nrg2-001]

 
Come back to gene ENSMUSG00000060275


For any suggestions or comments, please send an email to unitrap@crg.es