Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13725F2
Clone ID IST13725F2
Vector VICTR74
Project tigm

Sequence tag IST13725F2BBF1
Sequence
CTTCCAAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI11991 UNI15874 UNI32438 UNI32895 UNI32896 UNI35008

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 39698394..39698462 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117444529..117444597 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 7315798..7315866 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101503992..101504060 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 29457558..29457626 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 82702098..82702166 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31851983..31852051 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21873456..21873524 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061544 (BC043476) BC043476 protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q80ZY7]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 37871780..37871848 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023036 (Pcdhgc4) NM_033583 protocadherin gamma subfamily A, 11 Gene [Source:MGI Symbol;Acc:MGI:1935228]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5890809..5890877 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30207572..30207640 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 86728836..86728904 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 87226864..87226932 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082443 (AL954813.14)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 18109817..18109885 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72757091..72757159 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29611995..29612063 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053898 (Ech1) NM_016772 enoyl coenzyme A hydratase 1, peroxisomal Gene [Source:MGI (curated);Acc:Ech1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13143964..13144032 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64909021..64909089 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032393 (Dpp8) NM_028906 dipeptidylpeptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1921638]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 130624531..130624599 69
NO GENE  

 
Come back to gene ENSMUSG00000032393


For any suggestions or comments, please send an email to unitrap@crg.es