Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14749B7
Clone ID IST14749B7
Vector VICTR76
Project tigm

Sequence tag IST14749B7BBF1
Sequence
AAACAACAACAACAAAAACCAACAGCTTTGTCCTCATTAGGGAATATAGAAACAAGAGAGCAAGGCCCTGCAGTTAAGAG
AAAGAGCTGCTCTTGTAGAAGATACAAGTTTGACCCCCAGCACTCAAGTCAGAGGGCTCAGAACTACCAGCAACTCCATG
GGGTCTGATACCTCTGGCCTCCATAGGGATCCTTACACATGTGGCATATGTATGTGAGCACACGTTCTCACATGCGTGTG
CGTGAGCACGCTCATGCACACAGACGCAGAGGACTTAAAATATAATTATTGAAAAAACTTAAAAAAAAAAAANCNNAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 135664181..135664492 312
NO GENE  


Sequence tag IST14749B7HMF1
Sequence
GTGTATCCCAGATACTTGCTGGGTTGTTTTGTTTTGTTTTCTGGCCTTGGTACCACTTAGCACTCTGGTGCAAAGCAGTT
TATTTCCGAGTGGAACAGCTGAAAGCTTTCTGGGCCTCTGCCTCTCTGTTTCCTTCTGCAGATTTTAGCTCCTCGTTGCA
CATGGCACGTACCATCAGCACGCGCTCCCAAGCAAAGGGACAGTGTGCACTATTTTTATTTCCTTCTTGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI10315

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88792219..88792451 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es