Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15068A7
Clone ID IST15068A7
Vector VICTR80
Project tigm

Sequence tag IST15068A7HMR1
Sequence
CTGGTAGCATAACCNATCAGGTATGGACACGTCACTCCTAGGCCTATATAAGCAGCACCATTTCTGGGCTCAGGGTCTTT
TGCCTATGCAATCAATGCTCTCCCAATAAATGTGTGCAGAAAATTTAAAAATTTAGCTCCTGCCTAGCTGCTTGTTGCAG
CGTCGTTCTTGCCATTACAAGATGGCGCTGGCTACCACATAATGGGATCTGGCACGCAGGTGTACACGCCAATACAGCAC
TCATATACATAAAATAAATAATAAAAAAATGGTTATCAAGAGTTGGAAGAGATGGCTCANAGGTTAGGACCCTGGTTCAA
TTCCCAGCACCTACATAGCAGTTTACACCTGTTTGTAACTCCAATTCCAGGAGAGCTGGTACCCTCACATAGTCATAAAT
ACAGGCAAAATACCAAAGTACATTAAAAACAAATAAATAAAAAAAAACCCAACAAACAAAAAAAGATTATCAAAATAACC
CCAGTGGCTTCNTTGCAGTTGGAATGGCTGACCTGAGGACCTGAGGAANCAGTTGTATCTCCTANGAGGCAGGGGCNNTT
TGCTTCNGGCTTNNNACGTGACTTANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64116977..64117561 563
 
EST/CDNA Est Name
  DT917993.1 - BY575554.1 - BY708235.1


Sequence tag IST15068A7BBF1
Sequence
CGGGCACCCTTATCTCCAGATACTCACTGTTGTCTGACAAGCCCATGGCTCAGGCTCAGTCTACCACCTGCTTTCTAGCT
CAGGGCTTCTATGACATCTCAGTCCTGGGGCACCCAAGTAAGCTCACCTTGAAGTCTGAAGAGCTAACAGGCTACAACCT
GCCCTCTGTGTGGAGGTACTGTACATACAGCTTTTTAGACACCCATGGGATCTAATAAGCCATGTATCAAATCAATAAAA
CCACCCTCCTTCCCAGCTTCCCTCCCTCTATGGCTCACTATCCCTCCCTCTGTGCCTTCCACAGTCCTTGTCTCCAGGTG
ACAGTGAGGTGGCTTCAGTGTAGGCTCTGCTTTCTGGGAAGCTGANACTTGGTTATCTCAAGGCTCCAATCTATTGGGAG
CTTGTCATTTGGANGCCCTCCCACTTTATTGCCTTGTTGTGAAAATTCAATTTCTTTTCATATTCCTATTCCTCTTTCAC
ATGAGTTATTCTTTATGTGACAN
Sequence Type genomic DNA
Unitrap ID UNI13404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62309422..62309923 498
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014245 (Pigl) NM_001039536 phosphatidylinositol glycan anchor biosynthesis, class L Gene [Source:MGI (curated);Acc:Pigl-001]


Sequence tag IST15068A7HMF2
Sequence
CATGCATGCAGGGACACGTACAGGCATGTGCACCCACGAACGTACATATAAGCACAAAGAATACCTTCATTAACACAGCT
ACTTAATTAGAATTAGAAGTAACATAGCCTTAGTACTGGGAAAGCTGATGCAGGAAAGACCCACATTCTAGGCTAGCTTA
GTTATACAGCAAGATTTAGGCTAACTGGTGGCTTCGGTGAGACATGTCTCAGCTACTTTCTGATCTCCCCAAAATTTGTT
TTGAATGCTCAAACTGAATTGGGTTGAACCTAATGCCAGATACATTTGAAGTAGTTGCTGTACCATTAAATTACATCACA
GCCACTGAACCTCATTTATATTAGCTTGTAATGTATGGAAATTTTAAAGAGGAGGAGCTAGAGAGATTGCTCAGTGGTTG
AGANCTCTTGCTGCCCATGGAGAGGANCCCAGTTTGGTCCCCAGCACCCACATTGTGGCTCTNNACNATTTGTAACTCNN
TCCTN
Sequence Type genomic DNA
Unitrap ID UNI17235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72842681..72843164 470
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034563 (Ccpg1) NM_028181 cell cycle progression 1 Gene [Source:MGI Symbol;Acc:MGI:1196419]

 
Come back to gene ENSMUSG00000034563


For any suggestions or comments, please send an email to unitrap@crg.es