Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12128G10
Clone ID IST12128G10
Vector VICTR76
Project tigm

Sequence tag IST12128G10HMR1
Sequence
GAGGTATGGACATGTGGGTGCTGGGAACTGAACCCTGGTCCTCCAGAAGAGCAGCTAGTGCTCTCAATCAAGGAGCCNCC
TCTCCAGCCCTTCTCTACCATTTTAATTCCTAGATAATAATCCACTAATTTGGTATGATATTACTGATTATGCTACTAGT
CCTTTCTCTTGTTTTTTATTTTTTAACTTTTGCTGCTTGGGATTGAACCCAGGACTTCACGTGTCCCAGGCCAGTATCTG
CCCTGAGCTTCATCTTTATCTCTCCCTGCTAACGTTGTTCAGCTTTCTGCTACTGAAGAGTCTTTGGCATTGACAGCTTG
ACAGTGGGGATGGCACCCCCACCACCCATTTCCNANGACTGGGTTCTCANNAACAAGACTGTGCTGTANGGCGGNANCTC
TTCCTGCCCGTGTCCACANACTGCCCACTTGTTTTGCTATANGCCTGCNNTGN
Sequence Type genomic DNA
Unitrap ID UNI16355

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101949573..101950020 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]


Sequence tag IST12128G10BBF1
Sequence
ACCTCCAGTTCCAGGGGAGCCAGTATCCTCATACAGACATGCAGGCAGGCAAAACACCAATGCACATAAACTAAGATATT
ACATGATAGTGAATTATAGAAAAATCACTAAGAGGACATCACGGGGAAATCGCAATGGAAAAACTGGGAATGAAAAACTG
GACTTTCCATGGTGATTGCAAATGGGAAAAACCTGAGTGAAAAGCTTCCAAGATGCTGAGTGCATGTCACAGGGACAGGC
TCCGATGACATTCCTTTGTCCTCCTCCACTCAATTTTTGCAATATGTGATATTTTAAAAACCCTTTATGATAGATTTTTT
TTCCTTATTTTCTAAAAGTCTTTCCTCTCNACNGNNNATACAAAGCAGCTGCTCACAAGACCNCATCCCACNGNGGGACC
CATCTCCAGGCTCCCTGTGCCCTTTCAAAAGAGCANGGATTTGCAAGCTCTTTTCTAAAACATTATCTTCTCNATGCCAA
AGTGCCTNANANTGCTGGATGCCATGACCTCCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101950016..101950528 487
 
EST/CDNA Est Name
  CK633898.1 - CN527209.1 - BB615291.1 - BB664369.1 - BB622520.1 - AI591432.1 - BB648353.1 - BB857854.1 - BY007731.1 - BY022021.1 - BY228698.1 - BY232852.1 - BY789605.1 - BY152880.1 - BY787212.1 - BY787244.1 - BY129488.1 - CF904850.1 - BY144268.1 - BY137848


Sequence tag IST12128G10HMF1
Sequence
ACCTCCAGTTCCAGGGGAGCCAGTATCCTCATACAGACATGCAGGCAGGCAAAACACCAATGCACATAAACTAAGATATT
ACNNGANNNNNGAATTATAGAAAAATCACTAAGAGGACATCACGGGGAAATCGCAATGGAAAAACTGGGAATGAAAAACT
GGACTTTCCATGGTGATTGCAAATGGGAAAAACCTGAGTGAAAAGCTTCCAAGATGCTGAGTGCATGTCACAGGGACAGG
CTCCGATGACATTCCTTTGTCCTCCTCCACTCAATTTTTGCAATATGTGATATTTNNAAAACCCTTTATGATAGATTNNN
NNTCCTTATTTTCTAANAGTCNTNNNTCTCTACTGNNNATACAAANCANCTGCTCACANGACCACATCCCACCGCGGGAC
CNATCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene CK633898.1 - CN527209.1 - BB615291.1 - BB664369.1 - BB622520.1 - AI591432.1 - BB648353.1 - BB857854.1 - BY007731.1 - BY022021.1 - BY228698.1 - BY232852.1 - BY789605.1 - BY152880.1 - BY787212.1 - BY787244.1 - BY129488.1 - CF904850.1 - BY144268.1 - BY137848


For any suggestions or comments, please send an email to unitrap@crg.es