Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12443B7
Clone ID IST12443B7
Vector VICTR76
Project tigm

Sequence tag IST12443B7HMF1
Sequence
GAGGAAGACTGAGGGATGGGGTCCAGCACATTATGGACCCCTTTANAGAATCCTGCCTGAGTCCAGGACCCGAAGTCTGG
TGTCAAACTCANAGACTGACAAGAAACCATTCTGTGCTCCGAGACTCCATCCAGTGTCATTGTGAAATCGTCCACTCACA
AAGCTACGGACTGCAGGGAAGGATCATTANAGACAAGCATGTGACAGACAACATCNTCTATGTCATCAAATGTTTCTCCA
GTTCTGCCTCACAGCCTGGTGCTGACAATACTCTCTTGGATGCANAAAGGAATCCTACTGAATTTGAGTCTTCTGAANCC
NANANCTTTCTAGCCCCAGCTCCGCCCATAGGAAGTACTTCCTCACTTCNNANCAGTTGGTCTGAANATCATAGTCCACA
GTTAGATCATANGCCTGATGANGACTTTCCCTTGAGGCCTGCTGTTCTCCCCCCANNNTATTGNNNNAATCNCACTGTTA
NNNANNNAGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12443B7BBF1
Sequence
ATGTCTGGCTTGCCCAGAATCCTACCGTTCANAGCACCCAGTTATGCGGTACCTGGCAGCAAGCCCTCCTTTTTGTGTAT
TTGTTGAGAGAAAATGCTGAGACAAGACAGGCATTGAAAGTTGGTCTTTCTCACCTCCTACAGCGTTTGCTACAGACTCC
TTCCCAGGGACAACTTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI17236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59497763..59497943 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es