Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10325E4
Clone ID IST10325E4
Vector VICTR76
Project tigm

Sequence tag IST10325E4HMF1
Sequence
AGTACCTTCCCTGTGTTTTATTTTTAAATATTGGATCTCCTTTCGCGTCTATTTTCTTCCGAAGCAGCAGCTGCGGTGGC
CCAGCAAGCTAGCCTCCCTTGCTTCTTTCTTAACACCTTTTGTTACTGAAGATGGGCTTTTTCTGTGCAAACTGTTTTCT
TTCACCTTTCAGTANCAGTTATTTATTAGACAACCAACCTTCCAGGCCTTCTGCAGGGTATACAGCTCTCCCACTGCTAA
GGAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI18155

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21693407..21693655 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028251 (2610029I01Rik) RIKEN cDNA 2610029I01 gene Gene [Source:MGI Symbol;Acc:MGI:1924282]


Sequence tag IST10325E4BBF1
Sequence
AGTACCTTCCCTGTGTTTTATTTTTAAATATTGGATCTCCTTTCGCGTCTATTTTCTTCCGAAGCAGCAGCTGCGGTGGC
CCAGCAAGCTAGCCTCCCTTGCTTCTTTCTTAACACCTTTTGTTACTGAAGATGGGCTTTTTCTGTGCAAACTGTTTTCT
TTNACCTTTCAGTAGCAGTTATTTATTAGACAACCAACCTTCCAGGCCTTCTGCAGGGTATACAGCTCTCCCACTGCTAA
GGAGTTAACCATACTCCTGGATGGGCGAGAAGGAGACAGATACAAGTCCATAGCCATATCCAGTACGACTGCAATAGAAA
GCCCTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI18155

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21693324..21693655 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028251 (2610029I01Rik) RIKEN cDNA 2610029I01 gene Gene [Source:MGI Symbol;Acc:MGI:1924282]

 
Come back to gene ENSMUSG00000028251


For any suggestions or comments, please send an email to unitrap@crg.es