Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13570H4
Clone ID IST13570H4
Vector VICTR74
Project tigm

Sequence tag IST13570H4HMR1
Sequence
GTCTCCTTTGAGCCGGTTTCAGGTTGATGCTAGCCTCACATTTAACTGCTTTGAATTCCTGAGCCTCCTGAATGCTGTGA
GGCAGATTGGCTAATGTTGATATTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTCCCCGTTTTTGTTTTTGTTTT
TTGGTTGGTTGTTTGGGGCCCACATCCTTAGAGCTCTTCATCCTTAGAGCTGGAATTAAAGTGGGTGGTGCTACAACTAG
TGTCTTCAGATGTTAATATTTGTCTTCCTGAAAGACCCAGCTTATTAACGATGTGATGGGCAGGGCTGGGTGGTGGTGTG
CTTGTTGGCAAGGTCATCCACCTGCTGTTAGGTGAATCTCTTTATATGCTAAAANAANCTTANTTCCTANAGACTTCCNN
NNCTGGAGATAGATCTGCCCTACNCTGTTGGCCTTTCATTTCNCTGNAGTNNGGNNATNAN
Sequence Type genomic DNA
Unitrap ID UNI2641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 27371632..27372081 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026917 (Wdr5) NP_543124 WD repeat domain 5 Gene [Source:MGI (curated);Acc:Wdr5-001]

 
Come back to gene ENSMUSG00000026917


For any suggestions or comments, please send an email to unitrap@crg.es