Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11838C9
Clone ID IST11838C9
Vector VICTR76
Project tigm

Sequence tag IST11838C9HMF1
Sequence
CTCTCCTCTGAGTTTCANTGCTCANAGCACTCTCTGCTGGCAAGCTCTCTTACAGGGAAGGTGCGCAGATATCTTGTATT
TGGACCTCCTCCTGGCCGAANAAAAAGGCCCAAAACAGGACCTTTCTCAGACACTGTGTTGCTTTGGCAGTTCCCAGGTG
GTACANACTCTCACCTAANCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAANATGGCGACCGCTGCTGCTGTG
GCTTAGGTCGCCTCCCCAGCCGGGCGGGCACCTGTCCTCTGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCACACAGGGT
GCTGCCTCAGCGCCTCTGTGCTTCTGCCTGTTCCNNAAGCTGTCNNGTTCTCTGGCGCACCCTCTCACCTGTTCANACTA
ATTTCCTANNTTCNGCGGGTCCCGGACCNAGATGGCNACCGCTGCTGCTGTGGCN
Sequence Type genomic DNA
Unitrap ID UNI30811 UNI31343 UNI31344 UNI31345

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 51974587..51975040 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 87952252..87952705 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21687432..21687885 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051341 (Zfp52) NM_144515 zinc finger protein 52 Gene [Source:MGI Symbol;Acc:MGI:99199]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 14099639..14100092 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 50994517..50994970 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 43846084..43846537 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 56018569..56019022 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27523528..27523981 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021879 (Dnahc7l) dynein, axonemal, heavy chain 7-like Gene [Source:MGI Symbol;Acc:MGI:2685130]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 9746947..9747400 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 24235143..24235596 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 70524163..70524616 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 16749868..16750321 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 81554081..81554534 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5054992..5055445 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 87629781..87630234 420
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 14209624..14210077 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026712 (Mrc1) NM_008625 mannose receptor, C type 1 Gene [Source:MGI (curated);Acc:Mrc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11616290..11616743 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]

 
Come back to gene ENSMUSG00000057715


For any suggestions or comments, please send an email to unitrap@crg.es